Journal: Molecular cell

Article Title: A consensus binding motif for the PP4 protein phosphatase

doi: 10.1016/j.molcel.2019.08.029

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: The heats per injection normalized per mole of injectant versus the titrant to titrate molar ratio were fitted to a single-site model. Data were analysed with MicroCal PEAQ-ITC analysis software.

Techniques: Virus, Recombinant, Protease Inhibitor, Plasmid Preparation, Purification, DNA Ligation, Mutagenesis, Software

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: (A) Volcano plot of differentially-expressed genes of TRAP-seq from neurons of the nodose ganglion (NG) and ileum myenteric iEAN isolated from Snap25RiboTag mice. Grey dots highlight all genes analyzed; red dots highlight genes significantly differentially expressed in ileum iEAN. Number of samples are indicated in parentheses. (B) Fluorescence in situ hybridization RNAScope® with probes for Nlrp6 and Elavl4 (pan-neuronal) in the ileum and colon from C57BL6/J mice. iEAN are outlined with a dashed line. Scale bars = 50 μm. Images representative of at least n=2 per group. (C) Scheme of the NLRP6 inflammasome pathway. (D) Neuronal quantification as assessed by IF staining (ANNA-1) in the ileum myenteric plexus on day 7 post-gavage of PBS or spiB of Casp1–/– Casp11–/– (ICE–/–) mice or heterozygous controls (ICE+/–). (E) Neuronal quantification (ANNA-1 staining) in the ileum myenteric plexus of Casp11–/– mice on day 7 post-spiB or -PBS gavage. (F) Scheme of i.v. AAV9–mediated transduction of peripheral neurons. (G, H) Representative confocal IF images of ileal (G) and colonic (H) myenteric plexus of Casp11flox/flox mice given i.v. injection of AAV9-hSyn-Cre-GFP or control viruses, stained with anti-ANNA-1 (red) antibodies. (I, J) (left) Neuronal quantification in the myenteric plexus of ileal (I) and colonic (J) segments from iEANΔCasp11 or Casp11flox/flox mice on day 7 post-spiB infection. (right) Quantification of the number of Cre-GFP transduced cells in the ileum myenteric plexus of iEANΔCasp11 mice. (K) Neuronal quantification in the ileum myenteric plexus from Snap25Cre–, Snap25Nlrp6flox/+ or Snap25ΔNlrp6 mice on day 7 post-spiB infection. Data are representative of 3–6 mice per condition. Data were analyzed by unpaired t-test or ANOVA with Tukey’s posthoc test and are shown as mean ± SD; n.s. - not significant, **p ≤ 0.01, ***p ≤ 0.001, ****p≤ 0.0001. See also Figure S3 and Supplemental Information.

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Isolation, Fluorescence, In Situ Hybridization, Staining, Transduction, Injection, Infection

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, DNA Extraction, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing Assay, Expressing

Journal: Cell reports

Article Title: Single-cell BCR and transcriptome analysis after influenza infection reveals spatiotemporal dynamics of antigen-specific B cells.

doi: 10.1016/j.celrep.2021.109286

Figure Lengend Snippet: Figure 6. Sustained generation of highly mutated Bmems (A) Graph showing Vh gene mutation frequency divided by UMAP clusters as in Figure 1C. Data are presented as the median and interquartile range. (B) Graphs showing Vh gene mutation frequency for each cluster, divided by dpi and organ. Data are presented as median and interquartile range. (C) Graphs showing Vh gene mutation frequency for each organ, divided by dpi and isotype. Two-way ANOVA with Tukey’s post test: for ‘‘All cells’’ at day 14, each isotype versus IgM, p < 0.0001; IgA versus IgG2b, p < 0.05; IgA versus IgG2c, p < 0.001; IgA versus IgG3, p < 0.01; IgG2c versus IgG1, p < 0.001. For ‘‘All cells’’ at day 28, each isotype versus IgM, p < 0.0001; IgA versus IgG1, p < 0.01; IgA versus IgG2b, p < 0.05; IgG2b versus IgG2c, p < 0.0001; IgG2c versus IgG3, p < 0.01; IgG2c versus IgG1, p < 0.0001; other comparisons ns. For ‘‘GC’’ at day 28, IgG1 versus IgM, p < 0.001; IgG2b versus IgM, p < 0.0001; IgG3 versus IgM, p < 0.01; IgG2c versus IgG1, p < 0.0001; IgG2c versus IgG2b, p < 0.0001; IgG2c versus IgG3, p < 0.0001. For ‘‘Bmem’’ at day 14, IgA versus IgM, p < 0.0001; IgA versus IgG2b, p < 0. 0001; IgA versus IgG2c, p < 0. 0001; IgA versus IgG3, p < 0.001. For ‘‘PB’’ at day 28, IgA versus IgM, p < 0.0001; IgA versus IgG2b, p < 0. 0001; IgA versus IgG2c, p < 0. 0001; IgG1 versus IgM. p < 0.01; IgG2b versus IgM, p < 0.01. All other comparisons are non-significant. Data are presented as medians and interquartile ranges. (D) UMAP plots of infected cells divided by organ and dpi, colored by mutation rate. Germline, not mutated; low, up to 1% nucleotide mutation; medium, up to 2%; and high, more than 2% mutation. (E) Graph showing proportion of cells for each mutation rate for each cluster, divided by dpi and organ. (F) Mice were infected with PR8 and injected with EdU at the indicated time windows. At day 35, mice were sacrificed, and lungs were subjected to flow cy- tometry. Shown is the frequency of EdU+ cells among the HA+ switched-memory-cell population. The experiment was performed once with n = 5 per group. Data are presented as means. (G) Violin plots comparing mutation frequency of total and GC-derived Bmems versus PBs. Statistical differences were tested using Student’s t test. Data are presented as medians and interquartile ranges. (H) Alluvial plot showing the proportion of PBs with a sequence identical to that of a Bmem, divided by dpi.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Click-iT Plus EdU Alexa Fluor 488 Flow Cytometry Assay Kit ThermoFisher Scientific C10633 Lung Dissociation Kit, mouse Miltenyi 130-095-927 LIVE/DEAD Fixable Aqua Dead Cell Stain Kit Invitrogen L34957 Chromium Single Cell 50 Library & Gel Bead Kit 10X Genomics 1000006 Chromium Single Cell 50 Library Construction Kit 10X Genomics 1000020 Chromium Single Cell V(D)J Enrichment Kit, Mouse B Cell 10X Genomics 1000072 Chromium Single Cell A Chip Kit, 16 rxns 10X Genomics 1000009 Chromium i7 Multiplex Kit 10X Genomics 120262 NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina 20024907 NovaSeq 6000 S1 Reagent Kit v1.5 (100 cycles) Illumina 20028319 NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles) Illumina 20024905 MiSeq Reagent Kit v2 (300-cycles) Illumina MS-102-2002 HiTrap Protein G High Performance Sigma Aldrich GE17-0404-03 1-step Ultra TMB-ELISA Thermo Fisher 34029 EasySep Mouse Pan-B Cell Isolation kit Stem Cell Technologies 19844 Deposited data Raw sequencing data files for single-cell RNA sequencing This paper ArrayExpress (E-MTAB-9478) Raw sequencing data files for single-cell VDJ sequencing This paper (ArrayExpress) E-MTAB-9491 Experimental models: Cell lines Expi293F ThermoFisher Scientific Cat#A14527 MDCK Lab of Jonathan W. Yewdell N/A Experimental models: Organisms/strains C57BL/6NTac Taconic Biosciences B6-F Oligonucleotides Primer for plasmid sequencing: 50-CTAACAGACTGTTCCTTTCCATG-30 This paper N/A Recombinant DNA Mouse IgG1 Heavy chain expression vector Lab of Jonathan W. Yewdell N/A Mouse kappa chain expression vector Lab of Jonathan W. Yewdell N/A Software and algorithms Graphpad Prism 9 Graphpad RRID: SCR_002798 FlowJo version 10 Tree Star RRID: SCR_008520 Excel Microsoft RRID: SCR_016137 Magellan Tecan https://lifesciences.tecan.com/software- magellan R (version 3.6) The Comprehensive R Archive Network https://cran.r-project.org/ RStudio (version 1.1.463) RStudio, Inc. https://www.rstudio.com/ Seurat (v3.0.1) Stuart et al., 2019 RRID: SCR_007322 Sauron This lab https://github.com/angelettilab/ scMouseBcellFlu Scripts for scRNA seq processing This lab https://github.com/angelettilab/ scMouseBcellFlu tradeSeq (Van den Berge et al., 2019) RRID: SCR_019238 Velocyto command line tool (La Manno et al., 2018) https://velocyto.org/velocyto.py/ scVelo (Bergen et al., 2019) RRID: SCR_018168 (Continued on next page) Cell Reports 35, 109286, June 22, 2021 e2

Techniques: Mutagenesis, Infection, Injection, Derivative Assay, Sequencing

Journal: Current environmental health reports

Article Title: Adverse Maternal Metabolic Intrauterine Environment and Placental Epigenetics: Implications for Fetal Metabolic Programming

doi: 10.1007/s40572-018-0217-9

Figure Lengend Snippet: Candidate-gene studies of placental DNA methylation, gestational diabetes, maternal glucose levels and prepregnancy obesity

Article Snippet: Bouchard et al 2013 Ref. 39 , N=98 IGT N=31 NGT N=67 French-Canadian Saguenay (Quebec, Canada) Cross-sectional E-21 birth cohort , Maternal glucose following 2h post-OGTT test (2 nd trimester, wk 24–28) , Bisulfite DNA pyrosequencing ADIPOQ promoter Pyrosequencing software QC standards. , Confounders (age, BMI, pregnancy weight change, insulin, HOMA-IR, and time between birth and placenta sampling) also evaluated using correlations to main variable; those significantly correlated were added to the linear models. No multiple-testing adjustment. , ↓ placental ADIPOQ methylation (fetal side) correlated with ↑ 2 nd trimester maternal glucose (r = −0.21; P <0.05). ↓ ADIPOQ methylation (maternal side) correlated with higher 2 nd trimester maternal insulin resistance index (r = −0.27; P <0.05). ↓ ADIPOQ methylation associated with ↑ maternal plasma adiponectin throughout pregnancy (r= −0.26 P <0.05)..

Techniques: DNA Methylation Assay, Control, Methylation, Expressing, Gene Expression, Biomarker Discovery, Software, Sampling, Clinical Proteomics